SimpleSearch - Line and FST details


Line specific information

 
Line ID 782B07
Vector Used pAC161
Line Availability available as T3 set from NASC (N474995)
Segregation Analysis 50:50:44
Confirmed for Hit At3g21180
Parent of DUPLO pair none
Parent of pair(s) 5397, 5414, 11339, 64201, 95069, 95070, 95071, 95072, 95073

Gene hit At3g21180

 
Sequence (A. th genome BLAST matches underlined) 
>50-K024966-022-782-B07-8409
AGCCACTTTTTCTCCAGTTTCAAAACCTCAACGATGAAAAAAGAAATATACAACTATGGG
ATCCTCCCTATAGTGAGTCGTATTACTCCCGGGGTTAGGCGGATTTGGTGGCTCGGTGGG
TTGGGGGGTTTGGGGG
GenBank Accession BX947611 [GenBank]
Graphic View Graphic view of gene At3g21180
Predicted Position of Insertion Chr3:7427079 - go to primer design
BLAST e Value 2e-17
Hit Clone Code (BAC ID) MXL8
Hit Gene Code At3g21180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation autoinhibited Ca(2 )-ATPase 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37