SimpleSearch - Line and FST details


Line specific information

 
Line ID 785A08
Vector Used pAC161
Line Availability available as T3 set from NASC (N475272)
Segregation Analysis 50:47:36
Confirmed for Hit At2g30310
Parent of DUPLO pair none
Parent of pair(s) 79239, 79270, 79299, 79437, 79506, 79633

Gene hit At2g30310

 
Sequence (A. th genome BLAST matches underlined) 
>57-K024972-022-785-A08-8409
GGTTACCACCAATGGAGACGTTTACCAATCCAAATGATCGCAAACATGACAAACATTTTG
AGATTTTGTGTGAAACCGGAAAACAAAGACTCCGTTTTGTACAATCAAAAACTACTAAAG
AAACTGCCTGAGATCCAAGCGTCTCTACCGGGAAGCAATTTCCTTTACGCCAACGTCTAC
GACCCATTGATGGACATGATCCAAAACCCTATGGGATCCTCCCTATAGTGAGA
GenBank Accession BX947813 [GenBank]
Graphic View Graphic view of gene At2g30310
Predicted Position of Insertion Chr2:12923819 - go to primer design
BLAST e Value 3e-87
Hit Clone Code (BAC ID) T9D9
Hit Gene Code At2g30310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GDSL-like Lipase/Acylhydrolase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37