SimpleSearch - Line and FST details


Line specific information

 
Line ID 794E08
Vector Used pAC161
Line Availability available as T3 set from NASC (N476184)
Segregation Analysis 35:35:20
Confirmed for Hit At5g50400
Parent of DUPLO pair none
Parent of pair(s) 3227, 6986

Gene hit At5g50400

 
Sequence (A. th genome BLAST matches underlined) 
>61-K024939-022-794-E08-8409
GNAGCCATTTACAATTGAATTATCCTGGATCACGCCAACAGTACGAGCAGGAGCACCTGT
GTCAAACAGTGTAGTAAGAATCAAAATGCAAATTCAGATAAAGAGAAAAGTGCATAGATT
TCTATGGGATCCTCCCTATAGTGAGTCNTATTACTCN
GenBank Accession BX948939 [GenBank]
Graphic View Graphic view of gene At5g50400
Predicted Position of Insertion Chr5:20524977 - go to primer design
BLAST e Value 1e-43
Hit Clone Code (BAC ID) MXI22
Hit Gene Code At5g50400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation purple acid phosphatase 27
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX948940 [GenBank]


Last Updated on 10.06.2021 13:37