SimpleSearch - Line and FST details


Line specific information

 
Line ID 796C12
Vector Used pAC161
Line Availability available as T3 set from NASC (N476356)
Segregation Analysis 50:50:44
Confirmed for Hit At2g17860
Parent of DUPLO pair none
Parent of pair(s) 4115, 4271, 93588, 93597, 93617, 93621, 93627, 93628

Gene hit At2g17860

 
Sequence (A. th genome BLAST matches underlined) 
>91-K024950-022-796-C12-8409
TGGGATCCTCCCTATAGTGAGGCCCACTTATGCGGCCGGACCATGCGGCGGGTATGGAGA
TGACTCTTGACTCAAAGGAGTTGAGGGAGAAACCCCTGGTGGGTAATGGAGCGGTG
GenBank Accession BX949142 [GenBank]
Graphic View Graphic view of gene At2g17860
Predicted Position of Insertion Chr2:7762751 - go to primer design
BLAST e Value 1e-30
Hit Clone Code (BAC ID) T13L16
Hit Gene Code At2g17860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pathogenesis-related thaumatin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37