SimpleSearch - Line and FST details


Line specific information

 
Line ID 803D09
Vector Used pAC106
Line Availability available as T3 set from NASC (N477037)
Segregation Analysis 50:34:27
Confirmed for Hit At3g16110
Parent of DUPLO pair 2663
Parent of pair(s) none

Gene hit At3g16110

 
Sequence (A. th genome BLAST matches underlined)
>68-K023409-022-803-D09-8409
AGCCATTTACAATTGAATATATCCTGATGACTGATATTATGCCACCTTGTATCGAAGACT
GATGACTTTGAAAGTCTATGGGATCCTCCCTATAGTGAGTCCTATTACTCAC
GenBank Accession BX949804 [GenBank]
Graphic View Graphic view of gene At3g16110
Predicted Position of Insertion Chr3:5462239 - go to primer design
BLAST e Value 4e-06
Hit Clone Code (BAC ID) MSL1
Hit Gene Code At3g16110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PDI-like 1-6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX949804 [GenBank]


Last Updated on 10.06.2021 13:37