SimpleSearch - Line and FST details


Line specific information

 
Line ID 805C04
Vector Used pAC106
Line Availability available as T3 set from NASC (N477212)
Segregation Analysis 50:7:4
Confirmed for Hit At4g22430
Parent of DUPLO pair 1603
Parent of pair(s) none

Gene hit At4g22430

 
Sequence (A. th genome BLAST matches underlined) 
>27-K023940w-022-805-C04-8409
TCCCTGCCTGTCCAGGTTCATTACTTTCTTTTGTGGTGTGGTGACGGTTGTTGACGAAGT
GGCAGCATATTGAAACCCAAAGGCACAATCCC
GenBank Accession BX949992 [GenBank]
Graphic View Graphic view of gene At4g22430
Predicted Position of Insertion Chr4:11828067 - go to primer design
BLAST e Value 4e-18
Hit Clone Code (BAC ID) F7K2
Hit Gene Code At4g22430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LOW protein: F-box/kelch-repeat protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX949992 [GenBank]


Last Updated on 10.06.2021 13:37