SimpleSearch - Line and FST details


Line specific information

 
Line ID 808B07
Vector Used pAC106
Line Availability available as T3 set from NASC (N477491)
Segregation Analysis 50:7:7
Confirmed for Hit At2g22420
Parent of DUPLO pair none
Parent of pair(s) 6685, 6689, 6691, 75939, 75956, 75959

Gene hit At2g22420

 
Sequence (A. th genome BLAST matches underlined) 
>50-K025561-022-808-B07-8409
CCTCTCAGAAGTATTCTTTGAATCATCAAATTCCGGTATGCGACGCAATCGCTGTTGCTT
GACAAAGCATCGCTAATGCTTGGTGACAAACTATCACTTTCATCATCGATTCACTATTAT
CTTTCGAAGCCCTTGACTACATTAGAGAAGCCCTATGGGATCCTCCCTATAGTGAGACAA
GenBank Accession CR398713 [GenBank]
Graphic View Graphic view of gene At2g22420
Predicted Position of Insertion Chr2:9513567 - go to primer design
BLAST e Value 3e-16
Hit Clone Code (BAC ID) F14M13
Hit Gene Code At2g22420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Peroxidase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37