SimpleSearch - Line and FST details
Line specific information
| Line ID | 815D06 |
| Vector Used | pAC106 |
| Line Availability | available as T3 set from NASC (N478186) |
| Segregation Analysis | 50:41:36 |
| Confirmed for Hit | At1g11650 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 61593, 93814 |
Gene hit At1g11650
| Sequence (A. th genome BLAST matches underlined) | >44-K025605-022-815-D06-8409 TCTTCAAAGCGGTTATATCTGACGCATTTTAATTTACTGTATGGGATCCTCCCTATAGTG AG |
| GenBank Accession | CR399139 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr1:3917127 - go to primer design |
| BLAST e Value | 4e-12 |
| Hit Clone Code (BAC ID) | F25C20 |
| Hit Gene Code | At1g11650 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | RNA-binding (RRM/RBD/RNP motifs) family protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on 10.06.2021 13:37 |




gabi-kat.de 
