SimpleSearch - Line and FST details
Line specific information
Line ID | 815D06 |
Vector Used | pAC106 |
Line Availability | available as T3 set from NASC (N478186) |
Segregation Analysis | 50:41:36 |
Confirmed for Hit | At1g11650 |
Parent of DUPLO pair | none |
Parent of pair(s) | 61593, 93814 |
Gene hit At1g11650
Sequence (A. th genome BLAST matches underlined) | >44-K025605-022-815-D06-8409 TCTTCAAAGCGGTTATATCTGACGCATTTTAATTTACTGTATGGGATCCTCCCTATAGTG AG |
GenBank Accession | CR399139 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr1:3917127 - go to primer design |
BLAST e Value | 4e-12 |
Hit Clone Code (BAC ID) | F25C20 |
Hit Gene Code | At1g11650 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | RNA-binding (RRM/RBD/RNP motifs) family protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on 10.06.2021 13:37 |