SimpleSearch - Line and FST details


Line specific information

 
Line ID 815D06
Vector Used pAC106
Line Availability available as T3 set from NASC (N478186)
Segregation Analysis 50:41:36
Confirmed for Hit At1g11650
Parent of DUPLO pair none
Parent of pair(s) 61593, 93814

Gene hit At1g11650

 
Sequence (A. th genome BLAST matches underlined)
>44-K025605-022-815-D06-8409
TCTTCAAAGCGGTTATATCTGACGCATTTTAATTTACTGTATGGGATCCTCCCTATAGTG
AG
GenBank Accession CR399139 [GenBank]
Graphic View Graphic view of gene At1g11650
Predicted Position of Insertion Chr1:3917127 - go to primer design
BLAST e Value 4e-12
Hit Clone Code (BAC ID) F25C20
Hit Gene Code At1g11650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA-binding (RRM/RBD/RNP motifs) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37