SimpleSearch - Line and FST details


Line specific information

 
Line ID 822B12
Vector Used pAC106
Line Availability available as T3 set from NASC (N478840)
Segregation Analysis 50:10:10
Confirmed for Hit At5g58300
Parent of DUPLO pair none
Parent of pair(s) 5945, 6027, 6056, 6060, 6075, 6079, 74812, 74822, 74831, 74836, 74842

Gene hit At5g58300

 
Sequence (A. th genome BLAST matches underlined) 
>90-K025507-022-822-B12-8409
AAGTATTGGATCCTCCGAAACACACACATAAATCCGATGTTTACAGTTTCGGTGTATGGG
ATCCTCCCTATAGTGAG
GenBank Accession CR360657 [GenBank]
Graphic View Graphic view of gene At5g58300
Predicted Position of Insertion Chr5:23574239 - go to primer design
BLAST e Value 6e-14
Hit Clone Code (BAC ID) MCK7
Hit Gene Code At5g58300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR360657 [GenBank]


Last Updated on 10.06.2021 13:37