SimpleSearch - Line and FST details


Line specific information

 
Line ID 839B07
Vector Used pAC106
Line Availability available as T3 set from NASC (N480467)
Segregation Analysis 50:27:14
Confirmed for Hit At2g32580
Parent of DUPLO pair none
Parent of pair(s) 6797, 39497

Gene hit At2g32580

 
Sequence (A. th genome BLAST matches underlined) 
>50-K025505-022-839-B07-8409
TTTACATTGAATAAAAACAATTCTTGTAGATCTACACAATTCTTGTCTATCTATCTGCAT
AGAGATTCAAACTCAAAATCCCTCATCAAGCTAAAGCATGCAATCTGGCAACTCAATCAC
CAACTACTACTAAACAATACCAAATATGAAAAAGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR361439 [GenBank]
Graphic View Graphic view of gene At2g32580
Predicted Position of Insertion Chr2:13828258 - go to primer design
BLAST e Value 5e-76
Hit Clone Code (BAC ID) T26B15
Hit Gene Code At2g32580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein, putative (DUF1068)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37