SimpleSearch - Line and FST details


Line specific information

 
Line ID 839D11
Vector Used pAC106
Line Availability available as T3 set from NASC (N480495)
Segregation Analysis 50:42:32
Confirmed for Hit At3g26480
Parent of DUPLO pair 737
Parent of pair(s) none

Gene hit At3g26480

 
Sequence (A. th genome BLAST matches underlined)
>84-K025536-022-839-D11-8409
TTTACATTGATTTTACTATTTACAAACCTAACATATGCAGGTTCAAATTTGCGATCATCA
TCCAGACGATGATGATCAAGTCCGGGTTAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR361472 [GenBank]
Graphic View Graphic view of gene At3g26480
Predicted Position of Insertion Chr3:9689050 - go to primer design
BLAST e Value 1e-36
Hit Clone Code (BAC ID) F20C19
Hit Gene Code At3g26480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin family protein / WD-40 repeat family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37