SimpleSearch - Line and FST details


Line specific information

 
Line ID 845C06
Vector Used pAC106
Line Availability available as T3 set from NASC (N2034715)
Segregation Analysis 50:4:2
Confirmed for Hit At3g60790
Parent of DUPLO pair 11883
Parent of pair(s) none

Gene hit At3g60790

 
Sequence (A. th genome BLAST matches underlined) 
>43-K025830-022-845-C06-8409
TCGGAATGAGCCTTTACAATTGAAGCATCACCTTAAGGAAGTTCCATTACCTTGGACACT
TTTGCTTCTGACATTAATTGCATCACTGGAGGATACATCGATGTCTTTATCATCAACTTT
TCAGTCACTGTTCCTTGTGTCACAAAACGTGACGCTAATGCAAATTCCTCTTCATTAGAA
CCATCGAAATTATACATCCACACAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR401375 [GenBank]
Graphic View Graphic view of gene At3g60790
Predicted Position of Insertion Chr3:22466918 - go to primer design
BLAST e Value 6e-82
Hit Clone Code (BAC ID) T4C21
Hit Gene Code At3g60790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR401374 [GenBank]


Last Updated on 10.06.2021 13:37