SimpleSearch - Line and FST details


Line specific information

 
Line ID 852D11
Vector Used pAC161
Line Availability available as T3 set from NASC (N481743)
Segregation Analysis 50:40:32
Confirmed for Hit At4g01110
Parent of DUPLO pair 12577
Parent of pair(s) none

Gene hit At4g01110

 
Sequence (A. th genome BLAST matches underlined) 
>84-K025757-022-852-D11-8409
CGTTTCGAAATCATCTGCGGCTAACTCACTGCCGAGTCAACGTTACCGTAATAGTAACGT
AACTTCCCGTTAGGGTTTCTGAAATCAAGCCTCGCTGTAGCCTCCGCCGTCAACTGCGAT
AAACCGTCGCCGGCTTTCCCACCGGAAAAGTTGAAATTGCTGACGCGGAAAGAGGAGAGA
CGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR402138 [GenBank]
Graphic View Graphic view of gene At4g01110
Predicted Position of Insertion Chr4:480583 - go to primer design
BLAST e Value 2e-81
Hit Clone Code (BAC ID) F2N1
Hit Gene Code At4g01110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation late embryogenesis abundant hydroxyproline-rich glycoprotein family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR402139 [GenBank]


Last Updated on 10.06.2021 13:37