SimpleSearch - Line and FST details


Line specific information

 
Line ID 855D07
Vector Used pAC161
Line Availability available as T3 set from NASC (N482027)
Segregation Analysis 50:35:28
Confirmed for Hit At2g20340
Parent of DUPLO pair 12795
Parent of pair(s) none

Gene hit At2g20340

 
Sequence (A. th genome BLAST matches underlined)
>52-K025758-022-855-D07-8409
ATCCTGCTTCTTGTTCTTGTTCTTGTTCTTGGCTTCTCTGCGGGATAATGTTGTTAAATC
AATATATATGTATTGGCTTTGCGTGGGAAACAGGCTTTATCGGGGAAAATCGTATGGGAT
CCTCCCTATAGTGAG
GenBank Accession CR402469 [GenBank]
Graphic View Graphic view of gene At2g20340
Predicted Position of Insertion Chr2:8782279 - go to primer design
BLAST e Value 2e-57
Hit Clone Code (BAC ID) F11A3
Hit Gene Code At2g20340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37