SimpleSearch - Line and FST details


Line specific information

 
Line ID 857A11
Vector Used pAC161
Line Availability available as T3 set from NASC (N2023338)
Segregation Analysis 50:1:1
Confirmed for Hit At3g44428
Parent of DUPLO pair none
Parent of pair(s) 85548, 85561, 85562, 85563

Gene hit At3g44428

 
Sequence (A. th genome BLAST matches underlined)
>81-K025967-022-857-A11-8409
GTATTTATTAATCTCCATTTTTTCAGTCCTTAGATATTTTTTTTCATGTAATGGTAATTT
GTATTATTAATATTTCTAATAAAATGATAGTTCTTTTAGTAATTTGTTAATCACTACCTA
AATTGTTTTGTAATAAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR402666 [GenBank]
Graphic View Graphic view of gene At3g44428
Predicted Position of Insertion Chr3:16067457 - go to primer design
BLAST e Value 6e-48
Hit Clone Code (BAC ID) T22K7
Hit Gene Code At3g44428 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ECA1 gametogenesis related family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR402665 [GenBank]


Last Updated on 10.06.2021 13:37