SimpleSearch - Line and FST details


Line specific information

 
Line ID 859B10
Vector Used pAC161
Line Availability available as T3 set from NASC (N482390)
Segregation Analysis 50:11:10
Confirmed for Hit At4g35810
Parent of DUPLO pair none
Parent of pair(s) 96767, 96768, 96769

Gene hit At4g35810

 
Sequence (A. th genome BLAST matches underlined) 
>74-K025970-022-859-B10-8409
AGATCAAGCAAAAACACAAAACATCAGAGAATCATATCCCTAACCTCTCCTGGATCGTTT
GTATGGGATCCTCCCTATAGTGAGA
GenBank Accession CR402934 [GenBank]
Graphic View Graphic view of gene At4g35810
Predicted Position of Insertion Chr4:16969154 - go to primer design
BLAST e Value 3e-25
Hit Clone Code (BAC ID) F4B14
Hit Gene Code At4g35810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR402935 [GenBank]


Last Updated on 10.06.2021 13:37