SimpleSearch - Line and FST details


Line specific information

 
Line ID 859E04
Vector Used pAC161
Line Availability available as T3 set from NASC (N482420)
Segregation Analysis 50:13:9
Confirmed for Hit At5g20885
Parent of DUPLO pair 1271
Parent of pair(s) none

Gene hit At5g20885

 
Sequence (A. th genome BLAST matches underlined)
>29-K025971-022-859-E04-8409
TACAATTGATCATTCTTTATATAGGTTAAGTAGCTATTTAACCTATCAGCGTAGGGCATT
CTTCCTATGGCGAGCACCACACGACGTCGTATTAGCAGCAAGTAGCGGAGTTCTACAAAG
AGGACACGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR402969 [GenBank]
Graphic View Graphic view of gene At5g20885
Predicted Position of Insertion Chr5:7084165 - go to primer design
BLAST e Value 2e-23
Hit Clone Code (BAC ID) F22D1
Hit Gene Code At5g20885 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37