SimpleSearch - Line and FST details


Line specific information

 
Line ID 859H01
Vector Used pAC161
Line Availability available as T3 set from NASC (N482453)
Segregation Analysis 50:5:1
Confirmed for Hit At3g01328
Parent of DUPLO pair none
Parent of pair(s) 90392, 90400, 90407, 90413, 90419, 90420, 90422

Gene hit At3g01328

 
Sequence (A. th genome BLAST matches underlined)
>08-K025970-022-859-H01-8409
GAATCTTTGTCCCCACCTCATCTCACCGCATTGAAACATCCCGCCACCTGTGTAATTGGC
GTTGTCTGTTTACTTGTATGGGATCCTCCCTATAGTGAGACCNANNNNNCCCCCC
GenBank Accession CR403014 [GenBank]
Graphic View Graphic view of gene At3g01328
Predicted Position of Insertion Chr3:117393 - go to primer design
BLAST e Value 5e-27
Hit Clone Code (BAC ID) T22N4
Hit Gene Code At3g01328 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ECA1-like gametogenesis related family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37