SimpleSearch - Line and FST details


Line specific information

 
Line ID 861H03
Vector Used pAC161
Line Availability available as T3 set from NASC (N482647)
Segregation Analysis 50:5:3
Confirmed for Hit At1g23240
Parent of DUPLO pair none
Parent of pair(s) 9515, 97362, 97364

Gene hit At1g23240

 
Sequence (A. th genome BLAST matches underlined)
>24-K025974-022-861-H03-8409
GACATGAANCATTTACAATTGAATATATCCTGACACTTTTGTAAAGTTGGATTTTGTAAT
TATGTATGGAATCCTCCCTATAGTGAGAATGCTACGGTATCCTATCCTCCCTATAGTGA
GenBank Accession CR403257 [GenBank]
Graphic View Graphic view of gene At1g23240
Predicted Position of Insertion Chr1:8253350 - go to primer design
BLAST e Value 6e-08
Hit Clone Code (BAC ID) F26F24
Hit Gene Code At1g23240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Caleosin-related family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37