SimpleSearch - Line and FST details


Line specific information

 
Line ID 873D02
Vector Used pAC161
Line Availability available as T3 set from NASC (N798886)
Segregation Analysis 50:2:2
Confirmed for Hit At4g38220
Parent of DUPLO pair none
Parent of pair(s) 69675, 97643

Gene hit At4g38220

 
Sequence (A. th genome BLAST matches underlined) 
>12-K026465-022-873-D02-8409
ACTCCCACACCGATGTCGTTCCCTTCGAGGACTCCAAGTGGACTCACCATCCGCTCCAAG
CTCACATGGACCACCATGGCGACATCTATGCCAGGGGTTCCCAGGACATGAAGTGCGTCG
GGATGCAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR404800 [GenBank]
Graphic View Graphic view of gene At4g38220
Predicted Position of Insertion Chr4:17925519 - go to primer design
BLAST e Value 1e-67
Hit Clone Code (BAC ID) F20D10
Hit Gene Code At4g38220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Peptidase M20/M25/M40 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37