SimpleSearch - Line and FST details


Line specific information

 
Line ID 877C08
Vector Used pAC161
Line Availability available as T3 set from NASC (N484128)
Segregation Analysis 50:4:4
Confirmed for Hit At4g26100
Parent of DUPLO pair none
Parent of pair(s) 3439, 3468, 9802, 84369, 84379, 84385, 84405, 84406, 84408, 84409, 84410

Gene hit At4g26100

 
Sequence (A. th genome BLAST matches underlined) 
>59-K026469-022-877-C08-8409
TTAAATTCGATAATATTACAACAATGTTAGAGATAATGTGACGAATTCGATAATCCATAA
AATTAAAAACTAGAAAGTGAGAGAGAGACGAACCGAGATAGATCTCTCCAAACGAACCAC
TACCGATCTTTCGGCCGAGACGAAACTTGTTCCCCACACGAGGTTCCATAAATAACCACG
AAACCCCTCGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR405285 [GenBank]
Graphic View Graphic view of gene At4g26100
Predicted Position of Insertion Chr4:13230357 - go to primer design
BLAST e Value 4e-92
Hit Clone Code (BAC ID) F20B18
Hit Gene Code At4g26100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation casein kinase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR405285 [GenBank]


Last Updated on 10.06.2021 13:37