SimpleSearch - Line and FST details


Line specific information

 
Line ID 893B07
Vector Used pAC161
Line Availability available as T3 set from NASC (N485651)
Segregation Analysis N/A (line seemingly not resistant, T2 plants grown without drug)
Confirmed for Hit At5g40510
Parent of DUPLO pair 7998
Parent of pair(s) none

Gene hit At5g40510

 
Sequence (A. th genome BLAST matches underlined)
>50-K030001-022-893-B07-8409
GGATCCCTGGTCACTCGTGCGCCACATCTCTTGTCACGACTAGCATGAGTATGGGATCCT
CCCTATAGTGAGTCGTATTACTCACGCCCTTTGGGGACCCCCGCTGCGGACATCCCTGTG
GCCCTCCCGTTTTTGCCCTTTCCCGCGCCCTTTTTTTTGTGGCCCGGGGGGGGGCCCTTT
GenBank Accession CR935575 [GenBank]
Graphic View Graphic view of gene At5g40510
Predicted Position of Insertion Chr5:16230089 - go to primer design
BLAST e Value 6e-08
Hit Clone Code (BAC ID) K21I16
Hit Gene Code At5g40510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Sucrase/ferredoxin-like family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37