SimpleSearch - Line and FST details


Line specific information

 
Line ID 895B09
Vector Used pAC161
Line Availability available as T3 set from NASC (N485845)
Segregation Analysis 60:60:59
Confirmed for Hit At3g13080
Parent of DUPLO pair none
Parent of pair(s) 84543, 84548, 84551, 84552, 84553, 84554

Gene hit At3g13080

 
Sequence (A. th genome BLAST matches underlined) 
>66-K030226-022-895-B09-8409
CATGTATAGAATCCTCCCTATGGAGATTCATACGTGGCAGTAGACGTGATCAGCAGCACT
TTATCTTGGGATGTCTCATCCTCTAACCCGACTCTCAAAGACATAAATTTCAAGGTCTTT
CCTGGGATGAAGGTTGCAATTTGTGGTATGGGATCCTCCCTATAGTGAGTCNNATTACTC
N
GenBank Accession CR935616 [GenBank]
Graphic View Graphic view of gene At3g13080
Predicted Position of Insertion Chr3:4199524 - go to primer design
BLAST e Value 3e-53
Hit Clone Code (BAC ID) MJG19
Hit Gene Code At3g13080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation multidrug resistance-associated protein 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR935617 [GenBank]


Last Updated on 10.06.2021 13:37