SimpleSearch - Line and FST details


Line specific information

 
Line ID 897H04
Vector Used pAC161
Line Availability available as T3 set from NASC (N486104)
Segregation Analysis 50:26:24
Confirmed for Hit At5g37060
Parent of DUPLO pair 2791
Parent of pair(s) none

Gene hit At5g37060

 
Sequence (A. th genome BLAST matches underlined) 
>32-K113888-0022-897-H04-8409
ATTTGTTTATTGCTTTCGCCTATAAATACGACGGATCGTAATTTGTCGTTTTATCAAAAT
GTACTTTCATTTTATAATAACGCTGCGGACATCTACATTTTTGAATTGAAAAAAAATTGG
TAATTACTCTTTCTTTTTCTCCATATTGACCATCATACTCATTGCTGATCCATGTAGATT
TCCCGGACATGAAGCCATGTAGTAGTCCCTTATCTATATTCGCAGTCCAGCTAACCAGAC
CGGCCG
GenBank Accession HE665502 [GenBank]
Graphic View Graphic view of gene At5g37060
Predicted Position of Insertion Chr5:14644001 - go to primer design
BLAST e Value 2e-09
Hit Clone Code (BAC ID) K15O15
Hit Gene Code At5g37060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cation/H exchanger 24
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HE665502 [GenBank]


Last Updated on 10.06.2021 13:37