SimpleSearch - Line and FST details


Line specific information

 
Line ID 899A04
Vector Used pAC161
Line Availability available as T3 set from NASC (N486212)
Segregation Analysis 50:49:21
Confirmed for Hit At1g75020
Parent of DUPLO pair 12533
Parent of pair(s) none

Gene hit At1g75020

 
Sequence (A. th genome BLAST matches underlined) 
>25-K030263-022-899-A04-8409
AATACTGAGCCCCGGGTATGGGATCCTCCCTATAGTGAGACGAATTACACAGTAGATAAT
AGCAAGACAAGCCAAAAGTTTGCAGCTGAACTTGGTCTTCCAGCACTATCAAACGTATGG
GATCCTCCCTATAGTGAGTCGTATTACTCACTTTCTTTTGGGATCTCCCT
GenBank Accession CR935774 [GenBank]
Graphic View Graphic view of gene At1g75020
Predicted Position of Insertion Chr1:28172533 - go to primer design
BLAST e Value 1e-18
Hit Clone Code (BAC ID) F25A4
Hit Gene Code At1g75020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation lysophosphatidyl acyltransferase 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR935774 [GenBank]


Last Updated on 10.06.2021 13:37