SimpleSearch - Line and FST details


Line specific information

 
Line ID 910H07
Vector Used pAC161
Line Availability available as T3 set from NASC (N487355)
Segregation Analysis 50:48:48
Confirmed for Hit At3g22425
Parent of DUPLO pair 2419
Parent of pair(s) none

Gene hit At3g22425

 
Sequence (A. th genome BLAST matches underlined) 
>56-K030973-022-910-H07-8409
CAGTCTATGTGCTCCTCCTCCTGTATGGGATCCTCCCTATAGTGATTCGATATTACTCAC
AGAGTATCTAAGGAAACGAATGTTTCAATGAANATTAATTTGGATGGTATGGGATC
GenBank Accession CT026734 [GenBank]
Graphic View Graphic view of gene At3g22425
Predicted Position of Insertion Chr3:7951284 - go to primer design
BLAST e Value 2e-10
Hit Clone Code (BAC ID) MCB17
Hit Gene Code At3g22425 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation imidazoleglycerol-phosphate dehydratase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CU458083 [GenBank] CT026734 [GenBank]


Last Updated on 10.06.2021 13:37