SimpleSearch - Line and FST details


Line specific information

 
Line ID 924D03
Vector Used pAC161
Line Availability available as T3 set from NASC (N488647)
Segregation Analysis 50:21:19
Confirmed for Hit At1g77120
Parent of DUPLO pair none
Parent of pair(s) 4596, 85333, 85340, 85348, 85350, 85352, 85354, 85355

Gene hit At1g77120

 
Sequence (A. th genome BLAST matches underlined) 
>20-K031607-022-924-D03-8409
CCTCATTCAAAGTTGCTCCGAACCCAGTAAACAAACCACAACTGGACGTACTGACCTTGT
CAAGAGGAGCATCCGGATTGATCTTANCNACCTGACCAGAGTGAACCNCTGAGTATGGG
GenBank Accession CT954579 [GenBank]
Graphic View Graphic view of gene At1g77120
Predicted Position of Insertion Chr1:28976623 - go to primer design
BLAST e Value 2e-32
Hit Clone Code (BAC ID) F22K20
Hit Gene Code At1g77120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alcohol dehydrogenase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37