SimpleSearch - Line and FST details


Line specific information

 
Line ID 929H02
Vector Used pAC161
Line Availability available as T3 set from NASC (N489174)
Segregation Analysis 50:50:40
Confirmed for Hit At5g42670
Parent of DUPLO pair none
Parent of pair(s) 6483, 6500, 6501, 6510, 6515, 10665, 10670, 11083, 95255, 95266, 95278, 95289, 95317, 95324, 95331, 95337, 95338, 95339

Gene hit At5g42670

 
Sequence (A. th genome BLAST matches underlined) 
>16-K113509-0022-929-H02-8409
GACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTTTCTCCATATT
GACCATCATACTCATTGCTGATCCATGTAGATTTCCCGGACATGAAGCCATTTACAGTTA
AATTCATAAATTTATCCATAGTTGTTTCCTTTTATCATTTCTGATGGATTCGTCGTCCAC
ACTATTTCTAAGATACATTTTTTGGCAGTCCTCAGGTGGAATATATTGACTAACCTGCCC
GGCCGCTACTAAGTTG
GenBank Accession HE666424 [GenBank]
Graphic View Graphic view of gene At5g42670
Predicted Position of Insertion Chr5:17110178 - go to primer design
BLAST e Value 2e-43
Hit Clone Code (BAC ID) MJB21
Hit Gene Code At5g42670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Agenet domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37