SimpleSearch - Line and FST details


Line specific information

 
Line ID 945C09
Vector Used pAC161
Line Availability available as T3 set from NASC (N490657)
Segregation Analysis 50:50:48
Confirmed for Hit At5g24160
Parent of DUPLO pair none
Parent of pair(s) 4616, 8455, 10001, 10067

Gene hit At5g24160

 
Sequence (A. th genome BLAST matches underlined)
>67-K032907-022-945-C09-8409
CGTGACTATATATACTAAATCAATGACTATAAATATTTGTGAACAAAGAAGTATCCTTTT
GACGTATGGGATCCTCCCTATAGTGAGACCTATT
GenBank Accession CT955467 [GenBank]
Graphic View Graphic view of gene At5g24160
Predicted Position of Insertion Chr5:8185444 - go to primer design
BLAST e Value 3e-28
Hit Clone Code (BAC ID) K12G2
Hit Gene Code At5g24160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation squalene monooxygenase 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR818364 [GenBank]


Last Updated on 10.06.2021 13:37