SimpleSearch - Line and FST details


Line specific information

 
Line ID 950H06
Vector Used pAC161
Line Availability available as T3 set from NASC (N491194)
Segregation Analysis 50:50:36
Confirmed for Hit At3g19420
Parent of DUPLO pair 1163
Parent of pair(s) none

Gene hit At3g19420

 
Sequence (A. th genome BLAST matches underlined) 
>48-K102149-0022-950-H06-8409
TCCGGAATGAGCATTTAAATTGAATATATCCTGAAGTGGCTTAATTCTCTGTTGCAGATA
ATGTAGCCACTTCTTCTGTACGGCATCATTTCTTTTTCTATGGGATCCTCCCTATAGTGA
GAGGTATTA
GenBank Accession CU458330 [GenBank]
Graphic View Graphic view of gene At3g19420
Predicted Position of Insertion Chr3:6733400 - go to primer design
BLAST e Value 9e-31
Hit Clone Code (BAC ID) MLD14
Hit Gene Code At3g19420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PTEN 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CU458330 [GenBank]


Last Updated on 10.06.2021 13:37