SimpleSearch - Line and FST details


Line specific information

 
Line ID 959B07
Vector Used pAC161
Line Availability available as T3 set from NASC (N491987)
Segregation Analysis 50:50:50
Confirmed for Hit At4g35470
Parent of DUPLO pair 2524
Parent of pair(s) none

Gene hit At4g35470

 
Sequence (A. th genome BLAST matches underlined)
>50-K034415-022-959-B07-8409
AGATTTCGCGTTTCTCGTCTCCAAAGATCATTCATGTATTGAACAACGGCCTGTAAGTAT
GATGAACTCATCCGTGAGTGAGTATGGGATCCTCCCTATAGTGAGAC
GenBank Accession CT955909 [GenBank]
Graphic View Graphic view of gene At4g35470
Predicted Position of Insertion Chr4:16848406 - go to primer design
BLAST e Value 2e-36
Hit Clone Code (BAC ID) F15J1
Hit Gene Code At4g35470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plant intracellular ras group-related LRR 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37