SimpleSearch - Line and FST details


Line specific information

 
Line ID 962C08
Vector Used pAC161
Line Availability available as T3 set from NASC (N492288)
Segregation Analysis 50:49:37
Confirmed for Hit At1g66920
Parent of DUPLO pair none
Parent of pair(s) 97109, 97113, 97114, 97115

Gene hit At1g66920

 
Sequence (A. th genome BLAST matches underlined)
>59-K101930-0022-962-C08-8409
AGACTTTGTCATTGAAGTTGCAAGCATGAGCCAAACTTCACATGTCAACATTGTTACCCT
GCTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession CU458441 [GenBank]
Graphic View Graphic view of gene At1g66920
Predicted Position of Insertion Chr1:24966226 - go to primer design
BLAST e Value 1e-20
Hit Clone Code (BAC ID) T4O24
Hit Gene Code At1g66920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37