SimpleSearch - Line and FST details


Line specific information

 
Line ID 963D01
Vector Used pAC161
Line Availability available as T3 set from NASC (N492389)
Segregation Analysis 50:47:47
Confirmed for Hit At5g45130
Parent of DUPLO pair none
Parent of pair(s) 6756, 86789

Gene hit At5g45130

 
Sequence (A. th genome BLAST matches underlined) 
>04-K034419-022-963-D01-8409
CATTTACACTTGATATATCCTGATTATGGCATCGGAATGGTTCTCCCAACAGGCCATGGG
CTACTGCAGTGAGTTCATCGTGTTGTGCTTAGATTCGTATGGGATCCTCCCTATAGTGAG
ACC
GenBank Accession CU458491 [GenBank]
Graphic View Graphic view of gene At5g45130
Predicted Position of Insertion Chr5:18246000 - go to primer design
BLAST e Value 1e-18
Hit Clone Code (BAC ID) K17O22
Hit Gene Code At5g45130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ras small GTP-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37