SimpleSearch - Line and FST details


Line specific information

 
Line ID 964B06
Vector Used pAC161
Line Availability available as T3 set from NASC (N492466)
Segregation Analysis 50:47:31
Confirmed for Hit At1g19540
Parent of DUPLO pair none
Parent of pair(s) 4489, 4552, 4631, 4706, 8498, 92401

Gene hit At1g19540

 
Sequence (A. th genome BLAST matches underlined) 
>42-K034420-022-964-B06-8409
TTCCATGACTAGAGCCATTTACACTTTTGCAGAGAGTAAGCCTCCAATGGATTTTTTGGT
GGGTCTGATCCATACAATCCTTGTGAAGAGTGACTTTACCTCCTTCACTATAGATCCTTC
TTTTGGAGTTGAGGCTTCCGAGCTTTACCCTGAAGTCAAGTATGGGATCCTCCCTATAGT
GAGACCTATTGN
GenBank Accession CU458503 [GenBank]
Graphic View Graphic view of gene At1g19540
Predicted Position of Insertion Chr1:6767074 - go to primer design
BLAST e Value 3e-72
Hit Clone Code (BAC ID) F18O14
Hit Gene Code At1g19540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NmrA-like negative transcriptional regulator family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37