SimpleSearch - Line and FST details


Line specific information

 
Line ID 968G03
Vector Used pAC161
Line Availability available as T3 set from NASC (N492907)
Segregation Analysis 50:40:22
Confirmed for Hit At3g14640
Parent of DUPLO pair none
Parent of pair(s) 5644, 5728, 10364, 10402, 10404, 10998, 11356, 11360, 95493

Gene hit At3g14640

 
Sequence (A. th genome BLAST matches underlined) 
>23-K033862-022-968-G03-8409
TCCCCATAATGAGTTGTCCAAACCACCAAAATATAAAATAGGAAGGAGAAAGCTCGAAGG
TGAATGTCTGTAGAATCAACGCCATTGCCATCTTTGCCTCTAACATGGCAAAATTCTGGC
CGATGCATATCCTCGGTCCCCATGCAAATGGAAAGAAGGAGACTTGGCTCTTTGTTGCCT
TTGAAAGACCGTCTTTGAATCTCTCAGGCTTAAATTCTGCTGCATCAGTACCCCACAGCA
TGGGGTCGCGTTGGACTATGGATCCTCCCTAAAATGAATCGTATTACTC
GenBank Accession CU458627 [GenBank]
Graphic View Graphic view of gene At3g14640
Predicted Position of Insertion Chr3:4921741 - go to primer design
BLAST e Value 6e-122
Hit Clone Code (BAC ID) MIE1
Hit Gene Code At3g14640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 72, subfamily A, polypeptide 10
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CU458628 [GenBank]


Last Updated on 10.06.2021 13:37