SimpleSearch - Line and FST details


Line specific information

 
Line ID 970H03
Vector Used pAC161
Line Availability available as T3 set from NASC (N493111)
Segregation Analysis 50:50:46
Confirmed for Hit At2g47630
Parent of DUPLO pair none
Parent of pair(s) 96653, 96656, 96663, 96665, 96666

Gene hit At2g47630

 
Sequence (A. th genome BLAST matches underlined) 
>24-K102025-0022-970-H03-8409
TCATACTCATTGCTAATCCATGTATATACGTCGTGAACACCCCCAACAATGCTTTTAGCT
TGCAGAGTCGGAGGTGATAATAAGATTGAAATGCAAATTATCTTGTTATGTTTAAAAATG
CAGATATCTGAGAAGTTAAAGCCACACCCTATAGTGCTTAGTCTGTTAACAAAAAAGACC
ACCCAATAGTAGTCGAGAAGGAGAGATCTACACAGACGATGATAAAAGCAACGGGAAAAG
TCTGGTGAAAGTGTATGCTGTTCGGAGAGCGAGAATAAGGAAGGTGAAGTA
GenBank Accession CU458714 [GenBank]
Graphic View Graphic view of gene At2g47630
Predicted Position of Insertion Chr2:19536030 - go to primer design
BLAST e Value 4e-36
Hit Clone Code (BAC ID) T30B22
Hit Gene Code At2g47630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CU458715 [GenBank] CU458714 [GenBank]


Last Updated on 10.06.2021 13:37