SimpleSearch - Line and FST details
Line specific information
Line ID | 971G06 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N493198) |
Segregation Analysis | 50:43:39 |
Confirmed for Hit | At4g27550 |
Parent of DUPLO pair | none |
Parent of pair(s) | 3630, 3653, 3826 |
Gene hit At4g27550
Sequence (A. th genome BLAST matches underlined) | >47-K102026-0022-971-G06-8409 CCTTAATTGATCTTGACTAATAATACACGACCACCTATGGAATCCTCTCT |
GenBank Accession | CU458733 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr4:13756130 - go to primer design |
BLAST e Value | 4e-08 |
Hit Clone Code (BAC ID) | F27G19 |
Hit Gene Code | At4g27550 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | trehalose-6-phosphatase synthase S4 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | HE667669 [GenBank] CU458733 [GenBank] |
Last Updated on 10.06.2021 13:37 |