SimpleSearch - Line and FST details
Line specific information
| Line ID | 971G06 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N493198) |
| Segregation Analysis | 50:43:39 |
| Confirmed for Hit | At4g27550 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 3630, 3653, 3826 |
Gene hit At4g27550
| Sequence (A. th genome BLAST matches underlined) | >47-K102026-0022-971-G06-8409 CCTTAATTGATCTTGACTAATAATACACGACCACCTATGGAATCCTCTCT |
| GenBank Accession | CU458733 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:13756130 - go to primer design |
| BLAST e Value | 4e-08 |
| Hit Clone Code (BAC ID) | F27G19 |
| Hit Gene Code | At4g27550 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | trehalose-6-phosphatase synthase S4 |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | HE667669 [GenBank] CU458733 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
