SimpleSearch - Line and FST details


Line specific information

 
Line ID 973G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N493396)
Segregation Analysis 50:50:41
Confirmed for Hit At1g05230
Parent of DUPLO pair none
Parent of pair(s) 5235, 5246, 5247, 5267, 5278, 5363, 10267, 74617

Gene hit At1g05230

 
Sequence (A. th genome BLAST matches underlined) 
>95-K112304-0022-973-G12-8409
CATACTCTGGATCACCTCCTTTATCCAATATCTTCATAGTCTCCATTTCCACCGGAGCAT
AGATAACATAGGATTCTGTAGGATCATTGCAGCTTCTGTTGTAAGATCAGCATATAGATA
TCGCTAACCTGCCCGGCC
GenBank Accession FR819630 [GenBank]
Graphic View Graphic view of gene At1g05230
Predicted Position of Insertion Chr1:1513609 - go to primer design
BLAST e Value 8e-06
Hit Clone Code (BAC ID) YUP8H12
Hit Gene Code At1g05230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeodomain GLABROUS 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37