DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_015923
Line Availability available from NASC (N515923) and ABRC (SALK_015923)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g31780

 
Sequence (A. th genome BLAST matches underlined) 
AGCTAGTGTTAAGTATAACAATTACGAAAATTAAAGTTTCTCTGGGCCCCACATGTTTTA
TTTGTATCATATCTATTTCACATTTTCGGGTGTAAAAAAATTCATCAAATTTTGTTTCTC
AGTTTTCTCTTGGATTTTAGGC
GenBank Accession ED575728 [GenBank]
Graphic View Graphic view of gene At2g31780
Predicted Position of Insertion Chr2:13514924 - go to primer design
BLAST e Value 7e-63
Hit Clone Code (BAC ID) F20M17
Hit Gene Code At2g31780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification 5' region
Confirmation Status unknown

Gene hit At5g17310

 
Sequence (A. th genome BLAST matches underlined) 
CACACTCATATATGGCTTTGTCGCCAGAGTCCAAGCTAGAACAAACCCCACAAACCCAGC
TATCGAGTTGGGACCCGAATT
GenBank Accession ED575727 [GenBank]
Graphic View Graphic view of gene At5g17310
Predicted Position of Insertion Chr5:5697429 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) MKP11
Hit Gene Code At5g17310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucose pyrophosphorylase 2
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37