DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_017105
Line Availability available from NASC (N517105) and ABRC (SALK_017105)
Confirmed for Hit At2g23420
Parent of DUPLO pair 771
Parent of pair(s) none

Gene hit At2g23420

 
Sequence (A. th genome BLAST matches underlined) 
ATCGGCTATTGATAAGAGATTCTTACACCCCCTAAGTCATTGTGTGCTAA
GenBank Accession ED576658 [GenBank]
Graphic View Graphic view of gene At2g23420
Predicted Position of Insertion Chr2:9973720 - go to primer design
BLAST e Value 1e-11
Hit Clone Code (BAC ID) F26B6
Hit Gene Code At2g23420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nicotinate phosphoribosyltransferase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g26290

 
Sequence (A. th genome BLAST matches underlined) 
TATTACCCAAGCCATTGCTAAGCTATTTCCTGTCCCAATTCACACACTTTTCAAAGTTAG
TAATACTATTGAATATTATCTAAATTATAAAAAATATATAGTTTTTTAAGAAGTTATTA
GenBank Accession ED576659 [GenBank]
Graphic View Graphic view of gene At2g26290
Predicted Position of Insertion Chr2:11193108 - go to primer design
BLAST e Value 2e-59
Hit Clone Code (BAC ID) T1D16
Hit Gene Code At2g26290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation root-specific kinase 1
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37