DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_026818c
Line Availability available from NASC (N669513) and ABRC (SALK_026818c)
Parent of DUPLO pair 12149
Parent of pair(s) none

Gene hit At3g26610

 
Sequence (A. th genome BLAST matches underlined) 
AAGCAATAGCCAATGCTAGAAGGAACCAAAGGCCCTTGTGTTTTGCCATATGAGTTCCAA
CACAAAGCT
GenBank Accession BZ663226 [GenBank]
Graphic View Graphic view of gene At3g26610
Predicted Position of Insertion Chr3:9780194 - go to primer design
BLAST e Value 3e-32
Hit Clone Code (BAC ID) MFE16
Hit Gene Code At3g26610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectin lyase-like superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37