DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_026920
Line Availability available from NASC (N526920) and ABRC (SALK_026920)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g10090

 
Sequence (A. th genome BLAST matches underlined) 
GGCCCATTATGGATAGAGAAGCCGCTCTGTTACATAAAAAGACTGAGTTTCTTGAGTCGT
GGTCTAACCCTTCGCCATAA
GenBank Accession BZ663325 [GenBank]
Graphic View Graphic view of gene At5g10090
Predicted Position of Insertion Chr5:3154037 - go to primer design
BLAST e Value 8e-27
Hit Clone Code (BAC ID) T31P16
Hit Gene Code At5g10090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37