DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_027592c
Line Availability available from NASC (N668010) and ABRC (SALK_027592c)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g61260

 
Sequence (A. th genome BLAST matches underlined) 
TCCCCATACGAACACTCACAATCGTTAAAAGGAAAGATGAGAAGAGAGAGAAAGCT
GenBank Accession BZ663982 [GenBank]
Graphic View Graphic view of gene At1g61260
Predicted Position of Insertion Chr1:22595055 - go to primer design
BLAST e Value 8e-20
Hit Clone Code (BAC ID) F11P17
Hit Gene Code At1g61260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cotton fiber (DUF761)
Insertion Classification TS2TE (5')
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37