DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_027724
Line Availability available from NASC (N527724) and ABRC (SALK_027724)
Parent of DUPLO pair 12197
Parent of pair(s) none

Gene hit At2g19520

 
Sequence (A. th genome BLAST matches underlined) 
ATGAGAGTCCTACTGTTGGCCCACGATGTGTATATCATGGCCATGAAGATACAGTAGAAG
ATGTGGCTTTCAGCCCGACGAGGTAACTTCTTAGAACAGACTCCTTCTATTGATATCGAG
TTTGTTTATGCATACTGCAGATATTTTCATGATTTTCTAATAATACTTCTGGTGAACTTT
TATACCGTGAAGTGCACAAGAATT
GenBank Accession BZ664112 [GenBank]
Graphic View Graphic view of gene At2g19520
Predicted Position of Insertion Chr2:8457919 - go to primer design
BLAST e Value 1e-102
Hit Clone Code (BAC ID) F3P11
Hit Gene Code At2g19520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin family protein / WD-40 repeat family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37