DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_029432c |
| Line Availability | available from NASC (N685547) and ABRC (SALK_029432c) |
| Confirmed for Hit | F24K9 |
| Parent of DUPLO pair | 1079 |
| Parent of pair(s) | none |
Gene hit At3g11405
| Sequence (A. th genome BLAST matches underlined) | ACATTCCCCGTTTCACAAAAATATTGTTTGACTTTTACTTTTTCGTTCTAAGATATCAAT CAAAATAATAATCTTTATTA |
| GenBank Accession | ED578015 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr3:3580605 - go to primer design |
| BLAST e Value | 1e-38 |
| Hit Clone Code (BAC ID) | F24K9 |
| Hit Gene Code | At3g11405 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | hypothetical protein |
| Insertion Classification | 5' region |
| Confirmation Status | confirmed, show confirmation sequences |
| Other FSTs Supporting this Hit | ED578014 [GenBank] BH753650 [GenBank] |
|
Last Updated on Thursday, 10 June 2021 13:37 |




gabi-kat.de 