DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_035019
Line Availability available from NASC (N535019) and ABRC (SALK_035019)
Parent of DUPLO pair 12388
Parent of pair(s) none

Gene hit At2g17110

 
Sequence (A. th genome BLAST matches underlined) 
ACAACTTGAATCGCAATCCTTATCTTTGTGGACAAACTTCTAACTAATTTTCGTGTTGAA
TCTACTTTTTGATTCTCGGCACCTCTTTCATCCATACGCTTAAGCT
GenBank Accession ED582493 [GenBank]
Graphic View Graphic view of gene At2g17110
Predicted Position of Insertion Chr2:7444249 - go to primer design
BLAST e Value 4e-54
Hit Clone Code (BAC ID) F6P23
Hit Gene Code At2g17110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632)
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37