DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_043499c
Line Availability available from NASC (N668156) and ABRC (SALK_043499c)
Parent of DUPLO pair none
Parent of pair(s) 2615

Gene hit At1g73410

 
Sequence (A. th genome BLAST matches underlined) 
GCTGGAAATGATGTCTTCCGATCATCGGGACTAAAAATATGATTATAACCACCAGAACTC
GenBank Accession BH748187 [GenBank]
Graphic View Graphic view of gene At1g73410
Predicted Position of Insertion Chr1:27602420 - go to primer design
BLAST e Value 1e-12
Hit Clone Code (BAC ID) T9L24
Hit Gene Code At1g73410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 54
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37