DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_050024
Line Availability available from NASC (N550024) and ABRC (SALK_050024)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g18950

 
Sequence (A. th genome BLAST matches underlined) 
CTGACAGCAGACTCTTTCTCGTTTTCGCTCTGACATTGGTAAAACTATATTTGCAGAAAC
ATTCTGCGGGATGATTCAGGGCATCTGAAAGTTGCAGACTTTGGAGTAAGCAAGCT
GenBank Accession BH751361 [GenBank]
Graphic View Graphic view of gene At4g18950
Predicted Position of Insertion Chr4:10377137 - go to primer design
BLAST e Value 2e-50
Hit Clone Code (BAC ID) F13C5
Hit Gene Code At4g18950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrin-linked protein kinase family
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37