DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_067074
Line Availability available from NASC (N567074) and ABRC (SALK_067074)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g13300

 
Sequence (A. th genome BLAST matches underlined) 
GTCGTGGTCCGGTGTAGCTCGCCGGCGATGTGCTTCTTCTACCCGTAGTCATTACGTCAC
AGAATAATTAAT
GenBank Accession BH911226 [GenBank]
Graphic View Graphic view of gene At1g13300
Predicted Position of Insertion Chr1:4558523 - go to primer design
BLAST e Value 4e-22
Hit Clone Code (BAC ID) T6J4
Hit Gene Code At1g13300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb-like transcription factor family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37