DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_069876
Line Availability available from NASC (N569876) and ABRC (SALK_069876)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g48950

 
Sequence (A. th genome BLAST matches underlined) 
ACAACTTGGTACACAATCTGCTTTTGCTTGCCGGAAATTTATACAATTCGAACTCACAAG
TCTATCAAATACGTGAAAAAGTTTTCCAATTTTCATTTTAGGTGAAATTAA
GenBank Accession BZ664324 [GenBank]
Graphic View Graphic view of gene At5g48950
Predicted Position of Insertion Chr5:19846993 - go to primer design
BLAST e Value 2e-47
Hit Clone Code (BAC ID) K19E20
Hit Gene Code At5g48950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Thioesterase superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37